EnglishFrenchSpanish

Ad


OnWorks favicon

fastx_barcode_splitter.pl - Online in the Cloud

Run fastx_barcode_splitter.pl in OnWorks free hosting provider over Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

This is the command fastx_barcode_splitter.pl that can be run in the OnWorks free hosting provider using one of our multiple free online workstations such as Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

PROGRAM:

NAME


fastx_barcode_splitter.pl - FASTX Barcode Splitter

DESCRIPTION


Barcode Splitter, by Assaf Gordon ([email protected]), 11sep2008

This program reads FASTA/FASTQ file and splits it into several smaller files, Based on
barcode matching. FASTA/FASTQ data is read from STDIN (format is auto-detected.) Output
files will be writen to disk. Summary will be printed to STDOUT.

usage: r.pl --bcfile FILE --prefix PREFIX [--suffix SUFFIX] [--bol|--eol]

[--mismatches N] [--exact] [--partial N] [--help] [--quiet] [--debug]

Arguments:

--bcfile FILE - Barcodes file name. (see explanation below.) --prefix PREFIX - File
prefix. will be added to the output files. Can be used

to specify output directories.

--suffix SUFFIX - File suffix (optional). Can be used to specify file

extensions.

--bol - Try to match barcodes at the BEGINNING of sequences.

(What biologists would call the 5' end, and programmers would call index 0.)

--eol - Try to match barcodes at the END of sequences.

(What biologists would call the 3' end, and programmers would call the end of the
string.) NOTE: one of --bol, --eol must be specified, but not both.

--mismatches N - Max. number of mismatches allowed. default is 1. --exact - Same
as '--mismatches 0'. If both --exact and --mismatches

are specified, '--exact' takes precedence.

--partial N - Allow partial overlap of barcodes. (see explanation below.)

(Default is not partial matching)

--quiet - Don't print counts and summary at the end of the run.

(Default is to print.)

--debug - Print lots of useless debug information to STDERR. --help -
This helpful help screen.

Example (Assuming 's_2_100.txt' is a FASTQ file, 'mybarcodes.txt' is the barcodes file):

$ cat s_2_100.txt | /build/fastx-toolkit-V6DvdY/fastx-toolkit-0.0.14/debian/fastx-
toolkit/usr/bin/fastx_barcode_splitter.pl --bcfile mybarcodes.txt --bol
--mismatches 2 \

--prefix /tmp/bla_ --suffix ".txt"

Barcode file format ------------------- Barcode files are simple text files. Each line
should contain an identifier (descriptive name for the barcode), and the barcode itself
(A/C/G/T), separated by a TAB character. Example:

#This line is a comment (starts with a 'number' sign) BC1 GATCT BC2 ATCGT BC3 GTGAT
BC4 TGTCT

For each barcode, a new FASTQ file will be created (with the barcode's identifier as part
of the file name). Sequences matching the barcode will be stored in the appropriate file.

Running the above example (assuming "mybarcodes.txt" contains the above barcodes), will
create the following files:

/tmp/bla_BC1.txt /tmp/bla_BC2.txt /tmp/bla_BC3.txt /tmp/bla_BC4.txt
/tmp/bla_unmatched.txt

The 'unmatched' file will contain all sequences that didn't match any barcode.

Barcode matching ----------------

** Without partial matching:

Count mismatches between the FASTA/Q sequences and the barcodes. The barcode which
matched with the lowest mismatches count (providing the count is small or equal to
'--mismatches N') 'gets' the sequences.

Example (using the above barcodes): Input Sequence:

GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

Matching with '--bol --mismatches 1':
GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG GATCT (1 mismatch, BC1) ATCGT (4 mismatches,
BC2) GTGAT (3 mismatches, BC3) TGTCT (3 mismatches, BC4)

This sequence will be classified as 'BC1' (it has the lowest mismatch count). If
'--exact' or '--mismatches 0' were specified, this sequence would be classified as
'unmatched' (because, although BC1 had the lowest mismatch count, it is above the maximum
allowed mismatches).

Matching with '--eol' (end of line) does the same, but from the other side of the
sequence.

** With partial matching (very similar to indels):

Same as above, with the following addition: barcodes are also checked for partial overlap
(number of allowed non-overlapping bases is '--partial N').

Example: Input sequence is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG (Same as above, but note
the missing 'G' at the beginning.)

Matching (without partial overlapping) against BC1 yields 4 mismatches:
ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG GATCT (4 mismatches)

Partial overlapping would also try the following match:
-ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

GATCT (1 mismatch)

Note: scoring counts a missing base as a mismatch, so the final mismatch count is 2 (1
'real' mismatch, 1 'missing base' mismatch). If running with '--mismatches 2' (meaning
allowing upto 2 mismatches) - this seqeunce will be classified as BC1.

Use fastx_barcode_splitter.pl online using onworks.net services


Free Servers & Workstations

Download Windows & Linux apps

  • 1
    VASSAL Engine
    VASSAL Engine
    VASSAL is a game engine for creating
    electronic versions of traditional board
    and card games. It provides support for
    game piece rendering and interaction,
    and...
    Download VASSAL Engine
  • 2
    OpenPDF - Fork of iText
    OpenPDF - Fork of iText
    OpenPDF is a Java library for creating
    and editing PDF files with a LGPL and
    MPL open source license. OpenPDF is the
    LGPL/MPL open source successor of iText,
    a...
    Download OpenPDF - Fork of iText
  • 3
    SAGA GIS
    SAGA GIS
    SAGA - System for Automated
    Geoscientific Analyses - is a Geographic
    Information System (GIS) software with
    immense capabilities for geodata
    processing and ana...
    Download SAGA GIS
  • 4
    Toolbox for Java/JTOpen
    Toolbox for Java/JTOpen
    The IBM Toolbox for Java / JTOpen is a
    library of Java classes supporting the
    client/server and internet programming
    models to a system running OS/400,
    i5/OS, o...
    Download Toolbox for Java/JTOpen
  • 5
    D3.js
    D3.js
    D3.js (or D3 for Data-Driven Documents)
    is a JavaScript library that allows you
    to produce dynamic, interactive data
    visualizations in web browsers. With D3
    you...
    Download D3.js
  • 6
    Shadowsocks
    Shadowsocks
    A fast tunnel proxy that helps you
    bypass firewalls This is an application
    that can also be fetched from
    https://sourceforge.net/projects/shadowsocksgui/.
    It ha...
    Download Shadowsocks
  • More »

Linux commands

Ad